Adenine - Adenine Adenine is one of the purine basess used in forming nucleotides of DNA and RNA. Adenine forms adenosine, a nucleoside, when attached to ribose and deoxyadenosine when attached to deoxyribose, and it forms Adenosine triphosphate, a nucleotide, when one or more phosphate group is added to adenosine. Adenosine triphosphate is used in all known cellular metabolisms as one of the basic methods of transferring chemical energy between reactions..
Nicotinamide adenine dinucleotide - Nicotinamide adenine dinucleotide \'Nicotinamide Adenine Dinucleotide (NAD) and Nicotinamide Adenine Dinucleotide Phosphate' (NADP) are two important coenzymes found in cells. NAD is used extensively in glycolysis and the citric acid cycle of cellular respiration. It forms NADP with the addition of a phosphate group (much as ADP forms ATP). NADP is produced in the preliminary cycles of photosynthesis, and is used in the later Calvin cycle of photosynthesis. It is used in many other anabolic reactions in various organisms, as well..
Vitamin - a single chemical substance, but all derivatives fulfill the same functions in organisms (or are converted into the active form by the organism), so taking just one of the derivatives is sufficient for good health. The derivatives differ in chemical structure and level of activity. Names Some obsolete vitamin names: Vitamin B - actually a complex of several vitamins: B-number, H, and M. Vitamin G - another name for riboflavin (vitamin B2) The usage of names in the format "vitamin letter" and "vitamin letter number" is diminishing. This is especially true for vitamins H, M, B1, B2, B3, and B5, which are usually called by their proper chemical names. On the other hand, vitamins D and E are still usually called by their symbolic names, and A and K don't even.
Genetic code - bases (called "triplets" or "codons") into amino acids. The mapping indicates, for example, that when the sequence "adenine, adenine, adenine" is encountered, the amino acid lysine should be produced. When the code is followed repeatedly, many amino acids are created, and are strung together to form proteins. In the process of protein biosynthesis, a sequence of DNA called a gene is first transcribed (copied) into RNA. The RNA is a sequence of repeating units (nucleotide bases). Each position in the RNA may have four possible "values", signified by the four types of bases: adenine, guanine, cytosine and uracil. This sequence of bases encodes a protein. A protein is a sequence of amino acids. There are twenty possible amino acids. The RNA is broken up into units of three, called a codon..
Gene sequencing - disease states. Within these chromosomes are long sections of DNA and this DNA holds most of the genetic information held by the cell. DNA has a double helix structure and the coding regions of the molecule are formed of four nucleotides bound to the DNA. These are adenine (A), cytosine (C), guanine (G) and thymine (T). A always pairs with T and C with G, and so these are known as base pairs. Although other nucleotides exist in RNA and in non-human species their purpose is much the same. The base pairs running along the DNA structure from a three letter code which holds information required to make RNA which in turn controls cell function, development, gene expression and protein production. The section of DNA which codes for a base pair.
Glucose-6-Phosphate Dehydrogenase deficiency - particular the form of malaria caused by Plasmodium falciparum, the most deadly form of malaria. The normal function of G6PD in the red blood cells is to maintain the level of nicotinamide adenine dinucleotide phosphate (NADPH). The NADPH in turn maintains the level of glutathione in these cells that helps protect the red blood cells against oxidative damage. Patients with G6PD are at risk of hemolytic anemia when they consume foods (the most commonly quoted ones are fava beans) or drugs [1] that induce oxidative stresses to their cells. In these individuals, severe infections can also lead to hemolytic anemia..
Flavin - riboflavin. The flavin moiety is often conjugated with an adenosine diphosphate to form flavin adenine dinucleotide (e.g. FAD), and in other circumstances, is found as flavin mononucleotide (or FMN), a phosphorylated form of riboflavin. The flavin group is capable of undergoing oxidation-reduction reactions, and can accept either one electron in a two step process or can accept two electrons at once. In the form of FADH2, it is one of the cofactors that can transfer electrons to the electron transfer chain. FMN is a prosthetic group found in NADH dehydrogenase and FAD is a cofactor in the enzymes D-amino acid oxidase, glucose oxidase, and xanthine oxidase. Flavin is also the name of a commune in the Aveyron département, in France.
Uracil - in DNA. Just like thymine, uracil can form a base pair with adenine via two hydrogen bonds, but it lacks the methyl group present in thymine. Uracil, in comparison to thymine, will more readily degenerate into cytosine. Uracil is also known as 2-oxy-4-oxy pyrimidine..
Erwin Chargaff - emigrated to New York. Chargaff became professor at the Columbia University. Chargaff's best known achievement was to show that in DNA the number of guanine units equals the number of cytosine units and the number of adenine units equals the number of thymine units. This strongly hinted towards the base pair makeup of the DNA..
DNA replication - three steps, initiation, replication and termination. Table of contents showTocToggle("show","hide") 1 Initiation 2 Replication 3 Termination Initiation In the initiation step, several key factors are recruited to an origin of replication. This is a sequence that is rich in adenine-thymine base pairs, which are more easily separated than cytosine-guanine base pairs. Once the strands are initially unwound, several factors come into play. The partially unwound strands form a "replication bubble", with one "replication fork" on either end. Each group of enzymes at the replication fork proceeds away from the origin, unwinding and replicating the DNA strands as they move. The factors involved are: A helicase, which unwinds the DNA ahead of the fork. A primase, which generates an RNA primer to be used in DNA replication. A DNA holoenzyme, which is.
Deoxyribose - stripped of the oxygen atom in what would be a hydroxyl group in ribose. Sugars are members of a group of chemical compounds called carbohydrates. Deoxyribose, like ribose, is capable of forming long chains of linked molecules. Genetic material in earthly life consists of chains of deoxyribose (chromosomes) with the nucleotides adenine, thymine, guanine and cytosine attached. This material is known as deoxyribonucleic acid, DNA for short. Some sections of genetic DNA (genes) serve as scripts for constructing lengths of RNA. The RNA in turn constitutes scripts for constructing the proteins, enzymes, etc. that determine how a living creature develops and functions..
Adenosine - Adenosine Adenosine is a nucleoside formed when adenine is attached to a ribose ring (also known as a ribofuranose) via a β-N9-glycosidic bond. Adenosine plays an important role in biochemical processes, such as energy transfer - as adenosine triphosphate (ATP) and adenosine diphosphate (ADP) - as well as in signal transduction as cyclic adenosine monophosphate, cAMP. If adenine is attached to a deoxyribose ring, it is known as a deoxyadenosine..
Base pair - usually double-stranded, the number of base pairs in the dsDNA strand equals the number of nucleotides in one of the strands. In DNA, adenine and thymine, as well as guanine and cytosine, can be a base pair. In RNA, thymine is replaced by uracil. The following figure shows the chemical structures of properly base-paired nucleic acids. Water molecules are shown providing hydrogen bonds in the major and minor grooves; in vivo, these positions may occupied by DNA-binding proteins instead of water. Chemical structure of base pair bonding. The larger nucleic acids, adenine and guanine, are members of a class of doubly-ringed chemical structures called purines; the smaller nucleic acids, cytosine and thymine (and uracil), are members of a class of singly-ringed chemical structures called pyrimidines. Purines are only complementary with pyrimidines:.
Thymine - nucleic acid found in DNA. It can base pair with adenine. Thymine combined with deoxyribose creates the nucleoside thymidine. Thymidine can be phosphorylated with one, two or three phosphoric acid groups, creating respectively TMP, TDP or TTP (thymidine mono- di- or triphosphate)..
Codon usage bias - to make their polypeptides, which are proteins or protein precursors. Because there are four possible nucleotides, adenine (A), guanine (G), cytosine (C) and thymine (T) in DNA, a triplet has the potential to distinguish between 64 amino acids. Due to this redundancy, many amino acids can be coded by more than one triplet. Organisms often show strong preference for one of the several codons that all encode the same given amino acid. Such preference may arise if the transfer RNA (tRNA) corresponding to the preferred codon translates faster than the alternative codons. In this scenario, the preferred codon would become more common in the genome and hence the concentration of preferred-codon tRNAs would be rate limiting. It would then be efficient for the preferred tRNA to be present at a higher.
Timeline of biology and organic chemistry - artificially synthesizes peptide amino acid chains and thereby shows that amino acids in proteins are connected by amino group-acid group bonds. 1911 - Thomas Morgan proposes that Mendelian factors are arranged in a line on chromosomes. 1926 - James Sumner shows that the urease enzyme is a protein. 1928 - Otto Diels and Kurt Alder discover the Diels-Alder cycloaddition reaction for forming ring molecules. 1928 - First antibiotic, penicillin, discovered by Alexander Fleming 1929 - Phoebus Levene discovers the sugar deoxyribose in nucleic acids. 1929 - Edward Doisy and Adolf Butenandt independently discover estrone. 1930 - John Northrop shows that the pepsin enzyme is a protein. 1931 - Adolf Butenandt discovers androsterone. 1932 - Hans Krebs discovers the urea cycle. 1933 - Tadeus Reichstein artificially synthesizes vitamin C; first vitamin synthesis..
Subsequence - the longest common subsequence, since G only has length 3, and the sequence < B,E,E,B > has length 4. It turns out the longest common subsequence of X and Y would be < B,E,G,C,E,B > Subsequences have applications to computer science, especially in the discipline of Bioinformatics, where computers are used to compare, analyze, and store DNA strands. Take two strands of DNA, say ORG1 = ACGGTGTCGTGCTATGCTGATGCTGACTTATATGCTA ORG2 = CGTTCGGCTATCGTACGTTCTATTCTATGATTTCTAA Subsequences are used to determine how similar the two strands of DNA are, using the DNA bases: adenine, guanine, cytosine and thymine. A common problem in subsequences is the Longest-common subsequence problem, where we use dynamic programming to find a maximum length subsequence of two or more sequences..
RNA - 1 Chemical structure 2 Messenger RNA 2.1 Untranslated Regions 2.2 Anti-sense mRNA 3 RNA genes 4 RNA as genetic material 5 Double-stranded RNA 6 Related articles Chemical structure RNA has 4 different bases: adenine, guanine, cytosine, and uracil. The first 3 bases are the same as those found in DNA, but uracil replaces thymine as the base complementary to adenine. This may be because uracil is energetically less expensive to produce, although it easily degenerates into cytosine. Thus, uracil is appropriate for RNA, where quantity is important but lifespan is not, whereas thymine is appropriate for DNA. Structurally, RNA is indistinguishable from DNA except for the critical presence (noted above) of an additional hydroxyl group attached to the pentose ring in the 2' position. This additional group gives the molecule far.
RNA gene - particular amino acid. For example, the codon for lysine is UUU; the anticodon is AAA. By matching a lysine-charged tRNA with the anticodon AAA to the codon UUU, proper translation is achieved. amino acid - Each tRNA is covalently attached to an appropriate amino acid by a dedicated enzyme called amino-acyl tRNA synthase. In the example above, a tRNA with the anticodon AAA would be coupled to the amino acid lysine. base modification - tRNA contains several bases that are not "canonical" bases, i.e. that are modified forms of the standard adenine, guanine, cytosine, and uracil bases. CCA tail - The sequence CCA is added to the 3' end of the tRNA molecule. This sequence is important for the recognition of tRNA by enzymes critical in translation. three-dimensional structure - All.
Quasispecies model - shuu'-steR] (see note 1) based on initial work done by Eigen. (see note 2). The model rests on four assumptions: The self-replicating entities can be represented as sequences composed of a small number of building blocks--for example, sequences of RNA consisting of the four bases adenine, guanine, cytosine, and uracil. New sequences enter the system solely as the result of a copy process, either correct or erroneous, of other sequences that are already present. The substrates, or raw materials, necessary for ongoing replication are always present in sufficient quantity. Excess sequences are washed away in an outgoing flux. Sequences may decay into their building blocks. The probability of decay does not depend on the sequences' age; old sequences are just as likely to decay as young sequences. In the quasispecies model,.
