Thymine - Thymine Thymine (C5H6N2O2, 2-oxy-4-oxy-5-methylpyrimidine, 5-methyluracil)is one of the basess of the nucleic acid found in DNA. It can base pair with adenine. Thymine combined with deoxyribose creates the nucleoside thymidine. Thymidine can be phosphorylated with one, two or three phosphoric acid groups, creating respectively TMP, TDP or TTP (thymidine mono- di- or triphosphate)..
Ultraviolet - the least harmful, but causes sunburns at high exposures. High intensities of UV-B light are hazardous to the eyes, and exposure can cause welder's flash (photokeratitis or arc eye). Both UV-B and UV-C damage collagen fibers and thereby accelerate aging of the skin. UV-B light has been linked to skin cancers such as melanoma. The radiation ionizes DNA molecules in skin cells, causing covalent bonds to form between adjacent thymine bases, producing thymidine dimers. Thymidine dimers do not base pair normally, which can cause distortion of the DNA helix, stalled replication, gaps, and misincorporation. These can lead to mutations, which can result in cancerous growths. The mutagenicity of UV radiation can be easily observed in bacteria cultures. This cancer connection is the reason for concern about ozone depletion and the ozone.
Genetic code - use the same genetic code. The standard version is given in the following tables, which show what amino acid each of the 43 = 64 possible codons specify (Table 1), and what codons specify each of the 20 amino acids involved in translation (Table 2). For instance, GAU codes for the amino acid Asp (asparagine), and Cys (cysteine) is coded for by the codons UGU and UGC. These are called forward and reverse codon tables, respectively. The bases in the table below are adenine, cytosine, guanine and uracil, which are used in the mRNA; in the DNA, thymine takes the place of uracil. Table 1 : Codon table. This table illustrates the 64 possible codon triplets. 2nd base U C A G 1st base U UUU Phenylalanine UUC Phenylalanine UUA Leucine.
Gene sequencing - these chromosomes are long sections of DNA and this DNA holds most of the genetic information held by the cell. DNA has a double helix structure and the coding regions of the molecule are formed of four nucleotides bound to the DNA. These are adenine (A), cytosine (C), guanine (G) and thymine (T). A always pairs with T and C with G, and so these are known as base pairs. Although other nucleotides exist in RNA and in non-human species their purpose is much the same. The base pairs running along the DNA structure from a three letter code which holds information required to make RNA which in turn controls cell function, development, gene expression and protein production. The section of DNA which codes for a base pair sequence which produces.
Uracil - is one of the four RNA bases, replacing thymine as found in DNA. Just like thymine, uracil can form a base pair with adenine via two hydrogen bonds, but it lacks the methyl group present in thymine. Uracil, in comparison to thymine, will more readily degenerate into cytosine. Uracil is also known as 2-oxy-4-oxy pyrimidine..
Erwin Chargaff - Chargaff became professor at the Columbia University. Chargaff's best known achievement was to show that in DNA the number of guanine units equals the number of cytosine units and the number of adenine units equals the number of thymine units. This strongly hinted towards the base pair makeup of the DNA..
DNA replication - steps, initiation, replication and termination. Table of contents showTocToggle("show","hide") 1 Initiation 2 Replication 3 Termination Initiation In the initiation step, several key factors are recruited to an origin of replication. This is a sequence that is rich in adenine-thymine base pairs, which are more easily separated than cytosine-guanine base pairs. Once the strands are initially unwound, several factors come into play. The partially unwound strands form a "replication bubble", with one "replication fork" on either end. Each group of enzymes at the replication fork proceeds away from the origin, unwinding and replicating the DNA strands as they move. The factors involved are: A helicase, which unwinds the DNA ahead of the fork. A primase, which generates an RNA primer to be used in DNA replication. A DNA holoenzyme, which is actually.
Deoxyribose - of the oxygen atom in what would be a hydroxyl group in ribose. Sugars are members of a group of chemical compounds called carbohydrates. Deoxyribose, like ribose, is capable of forming long chains of linked molecules. Genetic material in earthly life consists of chains of deoxyribose (chromosomes) with the nucleotides adenine, thymine, guanine and cytosine attached. This material is known as deoxyribonucleic acid, DNA for short. Some sections of genetic DNA (genes) serve as scripts for constructing lengths of RNA. The RNA in turn constitutes scripts for constructing the proteins, enzymes, etc. that determine how a living creature develops and functions..
Deamination - (shown up as uracil) and methylated cytosine (unaltered). In DNA, this spontaneous deamination is corrected for by the removal of uracil (product of cytosine deamination and not part of DNA) and replacement with cytosine. 5-methylcytosine Spontaneous deamination of 5-methylcytosine results in thymine and ammonia. In DNA, this reaction cannot be corrected because the repair mechanisms do not recognize thymine as erroneous (as opposed to uracil), and unless it affects the function of the gene, the mutation will persist. This flaw in the repair mechanism contributes to the rarity of CpG sites in the eukaryotic genome..
5-methylcytosine - properties. 5-methylcytosine is formed by the action of DNA methyltransferase on CpG sites. It can undergo spontaneous deamination to form thymine..
Base pair - double-stranded, the number of base pairs in the dsDNA strand equals the number of nucleotides in one of the strands. In DNA, adenine and thymine, as well as guanine and cytosine, can be a base pair. In RNA, thymine is replaced by uracil. The following figure shows the chemical structures of properly base-paired nucleic acids. Water molecules are shown providing hydrogen bonds in the major and minor grooves; in vivo, these positions may occupied by DNA-binding proteins instead of water. Chemical structure of base pair bonding. The larger nucleic acids, adenine and guanine, are members of a class of doubly-ringed chemical structures called purines; the smaller nucleic acids, cytosine and thymine (and uracil), are members of a class of singly-ringed chemical structures called pyrimidines. Purines are only complementary with pyrimidines: pyrimidine-pyrimidine.
Thymidine - Thymidine is a molecule (known as a nucleoside) that is formed when thymine is attached to a deoxyribose ring (also known as a deoxyribofuranose) via a β-N1-glycosidic bond. Thymidine can be phosphorylated with one, two or three phosphoric acid groups, creating respectively TMP, TDP or TTP (thymidine mono- di- or triphosphate)..
Codon usage bias - polypeptides, which are proteins or protein precursors. Because there are four possible nucleotides, adenine (A), guanine (G), cytosine (C) and thymine (T) in DNA, a triplet has the potential to distinguish between 64 amino acids. Due to this redundancy, many amino acids can be coded by more than one triplet. Organisms often show strong preference for one of the several codons that all encode the same given amino acid. Such preference may arise if the transfer RNA (tRNA) corresponding to the preferred codon translates faster than the alternative codons. In this scenario, the preferred codon would become more common in the genome and hence the concentration of preferred-codon tRNAs would be rate limiting. It would then be efficient for the preferred tRNA to be present at a higher concentration, and the.
CpG site - very few CpG sites in the eukaryotic genomes. This is due to the action of DNA methyltransferase, which recognizes these CpG sites and methylatess the cytosine, turning it into 5-methylcytosine. Following spontaenous deamination, the 5-methylcytosine converts into thymine. If this mutation has no effect (as in most cases), the error is not recognized by the repair machinery, thus resulting in the loss of the CpG site. However, there are regions of the DNA which have a high concentration of CpG sites. These regions are known as CpG islands, and found at the promoters of eukaryotic genes. Surprisingly, these CpG sites are unmethylated, and therefore any spontaneous deaminations of cytosine to uracil are recognized by the repair machinery and the CpG site is restored. Note: the mechanisms of methylation and de-methylation are.
Timeline of biology and organic chemistry - acid chains and thereby shows that amino acids in proteins are connected by amino group-acid group bonds. 1911 - Thomas Morgan proposes that Mendelian factors are arranged in a line on chromosomes. 1926 - James Sumner shows that the urease enzyme is a protein. 1928 - Otto Diels and Kurt Alder discover the Diels-Alder cycloaddition reaction for forming ring molecules. 1928 - First antibiotic, penicillin, discovered by Alexander Fleming 1929 - Phoebus Levene discovers the sugar deoxyribose in nucleic acids. 1929 - Edward Doisy and Adolf Butenandt independently discover estrone. 1930 - John Northrop shows that the pepsin enzyme is a protein. 1931 - Adolf Butenandt discovers androsterone. 1932 - Hans Krebs discovers the urea cycle. 1933 - Tadeus Reichstein artificially synthesizes vitamin C; first vitamin synthesis. 1935 - Rudolf Schoenheimer.
Subsequence - subsequence, since G only has length 3, and the sequence < B,E,E,B > has length 4. It turns out the longest common subsequence of X and Y would be < B,E,G,C,E,B > Subsequences have applications to computer science, especially in the discipline of Bioinformatics, where computers are used to compare, analyze, and store DNA strands. Take two strands of DNA, say ORG1 = ACGGTGTCGTGCTATGCTGATGCTGACTTATATGCTA ORG2 = CGTTCGGCTATCGTACGTTCTATTCTATGATTTCTAA Subsequences are used to determine how similar the two strands of DNA are, using the DNA bases: adenine, guanine, cytosine and thymine. A common problem in subsequences is the Longest-common subsequence problem, where we use dynamic programming to find a maximum length subsequence of two or more sequences..
RNA - DNA by the presence of an additional hydroxyl group, attached to each pentose ring; as well as by the use of uracil, instead of thymine. RNA transmits genetic information from DNA (via transcription) into proteins (by translation). Table of contents showTocToggle("show","hide") 1 Chemical structure 2 Messenger RNA 2.1 Untranslated Regions 2.2 Anti-sense mRNA 3 RNA genes 4 RNA as genetic material 5 Double-stranded RNA 6 Related articles Chemical structure RNA has 4 different bases: adenine, guanine, cytosine, and uracil. The first 3 bases are the same as those found in DNA, but uracil replaces thymine as the base complementary to adenine. This may be because uracil is energetically less expensive to produce, although it easily degenerates into cytosine. Thus, uracil is appropriate for RNA, where quantity is important but lifespan is.
PNA - groups, the binding between PNA/DNA strands is stronger than between DNA/DNA strands due to the lack of electrostatic repulsion. Early experiments with homopyrimidine strands (strands consisting of only one repeated pyrimidine base) have shown that the Tm ("melting" temperature) of a 6-base thymine PNA/adenine DNA double helix was 31°C in comparison to an equivalent 6-base DNA/DNA duplex that denatures at a temperature less than 10°C. Mixed base PNA molecules are true mimics of DNA molecules in terms of base-pair recognition. PNA/PNA binding is stronger than PNA/DNA binding. Synthetic peptide nucleic acid oligomers have been used in recent years in molecular biology procedures, diagnostic assays and antisense therapies. Due to their higher binding strength it is not necessary to design long PNA oligomers for use in these roles, which usually require oligonucleotide.
Polyphosphate - a bases on a complimentary chain. The entire system consists of two long chains which coil up in a helix-like structure. RNA is simular, the two differences being, the sugar ribose being used in the phosphate/sugar backbone rather than deoxyribose and uracil being used instead of thymine as the aromatic base. Sodium tri-polyphosphate (Na5P3O10) has been used widely as a constituent of laundry detergents, acting as a water softener in hard water regions and improving detergent performance. In recent years, concern has grown that this results in substantial amounts of phosphates entering the sewage system and thence to watercourses, resulting in eutrophication. This has led to the amounts of polyphosphates in detergents being legally controlled in a number of countries (e.g., Germany, Italy, Austria).
Purine - and guanine, are purines. In DNA, these bases form hydrogen bonds with their complementary pyrimidines thymine and cytosine. purine pyrimidine A T G C In RNA, the complement of A is uracil instead of thymine: purine pyrimidine A U G C These hydrogen bonding modes are for classical Watson-Crick base pairing. Other hydrogen bonding modes are seen in both DNA and RNA, although the additional 2'-hydroxyl group of RNA expands the configurations through which RNA can form hydrogen bonds. When purines are metabolized they produce (among other things) uric acid which can crystalize in joints causing gout..